Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of ModE regulog to Burkholderia mallei NCTC 10229

Reference regulog properties
Source regulog: ModE - Ralstonia
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor
Biological process: Molybdenum homeostasis
Effector: Molybdate
Phylum: Proteobacteria/beta
Propagated regulon:
Target genome Burkholderia mallei NCTC 10229
Orthologous TF(s) BMA10299_1671
Regulated genes 1
Built upon 8 sites [see more]
Predicted regulatory interactions in Burkholderia mallei NCTC 10229
Locus tag Position Score Sequence
Position: -27
Score: 4.7
Sequence: TCCGTTATAACCTCGCGTATATTACGAT
Locus tag: BMA10299_1674
BMA10299_1674 -27 4.7 TCCGTTATAACCTCGCGTATATTACGAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: modA
Ortholog function: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
Ralstonia solanacearum GMI1000 RSp0106 -57 4.8 GGCGTTATATCGGCCCGTATATTACGAT
Ralstonia pickettii 12J Rpic_3851 -58 4.4 ACCGTTATATCGGCTCGTATATTACGCC
Ralstonia metallidurans CH34 Rmet_0571 -63 4.8 TGCGCTATATACCCGCTTATATTGCGCG
Ralstonia eutropha JMP134 Reut_A0634 -82 4.8 CTCGCTATATACAGCCTTATATTGCGCC
Ralstonia eutropha H16 H16_A0677 -89 5 AGCGCTATATACAGACGTATATTGCGCG
Cupriavidus taiwanensis RALTA_A0633 -97 4.7 CGCGCTATATACAGACGTATATTGCGCC