Propagation of HcpR regulog to Thermosipho melanesiensis BI429

Reference regulog properties
Source regulog:	HcpR - Thermotogales
Regulator type:	Transcription factor
Regulator family:	CRP
Regulation mode:	activator
Biological process:	Nitrosative stress response
Effector:	Nitric oxide
Phylum:	Thermotogae
Propagated regulon:
Target genome	Thermosipho melanesiensis BI429
Orthologous TF(s)	Tmel_0756
Regulated genes	1

Built upon 20 sites [see more]

Predicted regulatory interactions in *Thermosipho melanesiensis BI429*
	Locus tag	Position	Score	Sequence
Position: -59 Score: 5.9 Sequence: AGCGTAACATAAGTTACGGA Locus tag: Tmel_0755
	Tmel_0755	-59	5.9	AGCGTAACATAAGTTACGGA
Supported by regulated orthologs from reference regulons
Ortholog gene name: ytfE
Ortholog function: Regulator of cell morphogenesis and NO signaling
Thermosipho melanesiensis BI429	Tmel_0755	-59	5.9	AGCGTAACATAAGTTACGGA
Thermotogales bacterium TBF 19.5.1	Kole_1155	-86	6.6	TCCGTAACATATGTTACCGA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --