Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of SO0193 regulog to Shewanella sp W3-18-1

Reference regulog properties
Source regulog: SO0193 - Shewanellaceae
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Fatty acid metabolism
Effector:
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Shewanella sp W3-18-1
Orthologous TF(s) Sputw3181_3683
Regulated genes 1
Built upon 11 sites [see more]
Predicted regulatory interactions in Shewanella sp W3-18-1
Locus tag Position Score Sequence
Position: -66
Score: 6.3
Sequence: ATTTTGAACATTGTTTTTTAT
Locus tag: Sputw3181_3683
Sputw3181_3683 -66 6.3 ATTTTGAACATTGTTTTTTAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: SO0193
Ortholog function: fatty acid metabolism/phospholipid synthesis transcriptional regulator, TetR family
Shewanella oneidensis MR-1 SO_0193 -66 6.2 ATTTTGAACGTTGTTTTTTAT
Shewanella putrefaciens CN-32 Sputcn32_3546 -66 6.3 ATTTTGAACATTGTTTTTTAT
Shewanella sp W3-18-1 Sputw3181_3683 -66 6.3 ATTTTGAACATTGTTTTTTAT
Shewanella sp ANA-3 Shewana3_0172 -67 5.1 ATTTTGAACGTTGTTTTTTTA
Shewanella sp MR-4 Shewmr4_0172 -66 6.2 ATTTTGAACGTTGTTTTTTAT
Shewanella sp MR-7 Shewmr7_0167 -66 6.2 ATTTTGAACGTTGTTTTTTAT
Shewanella baltica OS155 Sbal_4185 -66 6.2 ATTTTGAACGTTGTTTTTTAT
Shewanella frigidimarina NCIMB 400 Sfri_0121 -79 6.1 ATTGTGAACGTTGTTTTTTAT
Shewanella amazonensis SB2B Sama_0186 -96 5.4 TTAATAAACAGTGTTTTTTAT
-74 6.3 ATTGTGAACATTGTTTTTAAT
Shewanella loihica PV-4 Shew_0132 -70 6.3 ATTGTGAACATTGTTTTTTAT