Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing OG2516_07987 gene

Properties
Regulog: RutR - Rhodobacterales
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Pyrimidine utilization
Effector: Uracil
Phylum: Proteobacteria/alpha
Built upon 62 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Roseobacter sp. MED193
Position: -154
Score: 4.74924
Sequence: TTCGCACCAAACGGTCAAAA
Locus tag: MED193_10378
Name: pntD
Funciton: Predicted nucleoside ABC transporter, substrate-binding protein
Locus tag: MED193_10383
Name: OG2516_07987
Funciton: Conserved hypothetical protein
Locus tag: MED193_10388
Name: pntA
Funciton: Predicted nucleoside ABC transporter, ATP-binding protein
Locus tag: MED193_10393
Name: pntB
Funciton: Predicted nucleoside ABC transporter, permease protein 1
Locus tag: MED193_10398
Name: pntC
Funciton: Predicted nucleoside ABC transporter, permease protein 2
pntD-OG2516_07987-pntA-pntB-pntC -154 4.7 TTCGCACCAAACGGTCAAAA MED193_10378
© 2009-2020 RegPrecise