Orthologous regulated operons containing pntA gene

Properties
Regulog:	RutR - Rhodobacterales
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Pyrimidine utilization
Effector:	Uracil
Phylum:	Proteobacteria/alpha

Built upon 62 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Rhodobacterales bacterium HTCC2654
Position: -186 Score: 4.77753 Sequence: TTTTGAACGTCGGGTCAAAT Locus tag: RB2654_20923 Name: pntD Funciton: Predicted nucleoside ABC transporter, substrate-binding protein Locus tag: RB2654_20928 Name: pntA Funciton: Predicted nucleoside ABC transporter, ATP-binding protein Locus tag: RB2654_20933 Name: pntB Funciton: Predicted nucleoside ABC transporter, permease protein 1 Locus tag: RB2654_20938 Name: pntC Funciton: Predicted nucleoside ABC transporter, permease protein 2
pntD-pntA-pntB-pntC	-186	4.8	TTTTGAACGTCGGGTCAAAT	RB2654_20923
Roseobacter sp. MED193
Position: -154 Score: 4.74924 Sequence: TTCGCACCAAACGGTCAAAA Locus tag: MED193_10378 Name: pntD Funciton: Predicted nucleoside ABC transporter, substrate-binding protein Locus tag: MED193_10383 Name: OG2516_07987 Funciton: Conserved hypothetical protein Locus tag: MED193_10388 Name: pntA Funciton: Predicted nucleoside ABC transporter, ATP-binding protein Locus tag: MED193_10393 Name: pntB Funciton: Predicted nucleoside ABC transporter, permease protein 1 Locus tag: MED193_10398 Name: pntC Funciton: Predicted nucleoside ABC transporter, permease protein 2
pntD-OG2516_07987-pntA-pntB-pntC	-154	4.7	TTCGCACCAAACGGTCAAAA	MED193_10378
Silicibacter TM1040
Position: -122 Score: 5.2166 Sequence: TTTAGACCGGCTGGTCAAAA Locus tag: TM1040_3094 Name: pntD Funciton: Predicted nucleoside ABC transporter, substrate-binding protein Locus tag: TM1040_3095 Name: pntA Funciton: Predicted nucleoside ABC transporter, ATP-binding protein Locus tag: TM1040_3096 Name: pntB Funciton: Predicted nucleoside ABC transporter, permease protein 1 Locus tag: TM1040_3097 Name: pntC Funciton: Predicted nucleoside ABC transporter, permease protein 2
pntD-pntA-pntB-pntC	-122	5.2	TTTAGACCGGCTGGTCAAAA	TM1040_3094
Silicibacter pomeroyi DSS-3
Position: -142 Score: 5.13023 Sequence: CTCGGACCATTCGGTCAAAA Locus tag: SPO0379 Name: pntD Funciton: Predicted nucleoside ABC transporter, substrate-binding protein Locus tag: SPO0378 Name: pntA Funciton: Predicted nucleoside ABC transporter, ATP-binding protein Locus tag: SPO0377 Name: pntB Funciton: Predicted nucleoside ABC transporter, permease protein 1 Locus tag: SPO0376 Name: pntC Funciton: Predicted nucleoside ABC transporter, permease protein 2
pntD-pntA-pntB-pntC	-142	5.1	CTCGGACCATTCGGTCAAAA	SPO0379