Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing amiC gene

Properties
Regulog: RutR - Rhodobacterales
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Pyrimidine utilization
Effector: Uracil
Phylum: Proteobacteria/alpha
Built upon 62 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Jannaschia sp. CCS1
Position: -36
Score: 5.45752
Sequence: ATTTTACCATATGGTAAGGA
Locus tag: Jann_1306
Name: codA
Funciton: Cytosine deaminase (EC 3.5.4.1)
Locus tag: Jann_1305
Name: pytM
Funciton: Predicted pyrimidine ABC transporter, substrate-binding protein
Locus tag: Jann_1304
Name: amiC
Funciton: Predicted amidase
Locus tag: Jann_1303
Name: pytN
Funciton: Predicted pyrimidine ABC transporter, ATP-binding protein
Locus tag: Jann_1302
Name: pytO
Funciton: Predicted pyrimidine ABC transporter, permease protein 1
Locus tag: Jann_1301
Name: pytQ
Funciton: Predicted pyrimidine ABC transporter, permease protein 2
codA-pytM-amiC-pytN-pytO-pytQ -36 5.5 ATTTTACCATATGGTAAGGA Jann_1306
© 2009-2020 RegPrecise