Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Jann_0788 gene

Properties
Regulog: RutR - Rhodobacterales
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Pyrimidine utilization
Effector: Uracil
Phylum: Proteobacteria/alpha
Built upon 62 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Jannaschia sp. CCS1
Position: -65
Score: 5.56797
Sequence: TTTTGACCGTTTGGTCAACC
Locus tag: Jann_0789
Name: deoC
Funciton: Deoxyribose-phosphate aldolase (EC 4.1.2.4)
Locus tag: Jann_0788
Name: Jann_0788
Funciton: Hypothetical protein
Locus tag: Jann_0787
Name: Jann_0787
Funciton: Hypothetical protein
Locus tag: Jann_0786
Name: ald
Funciton: Aldehyde dehydrogenase (EC 1.2.1.3)
deoC-Jann_0788-Jann_0787-ald -65 5.6 TTTTGACCGTTTGGTCAACC Jann_0789
© 2009-2020 RegPrecise