Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing RSP_0188 gene

Properties
Regulog: RutR - Rhodobacterales
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Pyrimidine utilization
Effector: Uracil
Phylum: Proteobacteria/alpha
Built upon 62 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Rhodobacter sphaeroides 2.4.1
Position: -74
Score: 5.38228
Sequence: TATTTATCGTTTGGTAAAAA
Locus tag: RSP_0189
Name: pydX
Funciton: Pyridine nucleotide-disulphide oxidoreductase associated with reductive pyrimidine catabolism
Locus tag: RSP_0188
Name: RSP_0188
Funciton: DedA family integral membrane protein
Locus tag: RSP_0187
Name: pydA
Funciton: Dihydropyrimidine dehydrogenase [NADP+] (EC 1.3.1.2)
pydX-RSP_0188-pydA -74 5.4 TATTTATCGTTTGGTAAAAA RSP_0189