Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Jann_2702 gene

Properties
Regulog: RutR - Rhodobacterales
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Pyrimidine utilization
Effector: Uracil
Phylum: Proteobacteria/alpha
Built upon 62 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Jannaschia sp. CCS1
Position: -57
Score: 5.67797
Sequence: CCTTGACCGTTTGGTCAAAA
Locus tag: Jann_2709
Name: praX
Funciton: Omega-amino acid--pyruvate aminotransferase (EC 2.6.1.18)
Locus tag: Jann_2708
Name: Jann_2708
Funciton: Hypothetical protein
Locus tag: Jann_2707
Name: pydC
Funciton: Beta-ureidopropionase (EC 3.5.1.6)
Locus tag: Jann_2706
Name: Jann_2706
Funciton: hypothetical protein
Locus tag: Jann_2705
Name: pydB
Funciton: phenylhydantoinase
Locus tag: Jann_2704
Name: Jann_2704
Funciton: Hypothetical protein
Locus tag: Jann_2703
Name: pytA
Funciton: Pyrimidine ABC transporter, ATP-binding protein
Locus tag: Jann_2702
Name: Jann_2702
Funciton: Predicted N-acetyltransferase
Locus tag: Jann_2701
Name: pytB
Funciton: Pyrimidine ABC transporter, permease protein 1
Locus tag: Jann_2700
Name: pytC
Funciton: Pyrimidine ABC transporter, permease protein 2
Locus tag: Jann_2699
Name: pytD
Funciton: Pyrimidine ABC transporter, substrate-binding protein
praX-Jann_2708-pydC-Jann_2706-pydB-Jann_2704-pytA-Jann_2702-pytB-pytC-pytD -57 5.7 CCTTGACCGTTTGGTCAAAA Jann_2709