Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing SKA53_10669 gene

Properties
Regulog: RutR - Rhodobacterales
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Pyrimidine utilization
Effector: Uracil
Phylum: Proteobacteria/alpha
Built upon 62 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Loktanella vestfoldensis SKA53
Position: -39
Score: 5.92449
Sequence: TTTTGACCATCTGGTCAAAC
Locus tag: SKA53_10674
Name: pydC
Funciton: Beta-ureidopropionase (EC 3.5.1.6)
Locus tag: SKA53_10669
Name: SKA53_10669
Funciton: Hypothetical protein
Locus tag: SKA53_10664
Name: pydB
Funciton: phenylhydantoinase
Locus tag: SKA53_10659
Name: pytA
Funciton: Pyrimidine ABC transporter, ATP-binding protein
Locus tag: SKA53_10654
Name: pytB
Funciton: Pyrimidine ABC transporter, permease protein 1
Locus tag: SKA53_10649
Name: pytC
Funciton: Pyrimidine ABC transporter, permease protein 2
Locus tag: SKA53_10644
Name: pytD
Funciton: Pyrimidine ABC transporter, substrate-binding protein
pydC-SKA53_10669-pydB-pytA-pytB-pytC-pytD -39 5.9 TTTTGACCATCTGGTCAAAC SKA53_10674
© 2009-2020 RegPrecise