Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing MED193_05504 gene

Properties
Regulog: RutR - Rhodobacterales
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Pyrimidine utilization
Effector: Uracil
Phylum: Proteobacteria/alpha
Built upon 62 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Roseobacter sp. MED193
Position: -119
Score: 6.08052
Sequence: GTTTGACCAGTTGGTCAAAT
Locus tag: MED193_05519
Name: pydC
Funciton: Beta-ureidopropionase (EC 3.5.1.6)
Locus tag: MED193_05514
Name: pydB
Funciton: phenylhydantoinase
Locus tag: MED193_05509
Name: pytA
Funciton: Pyrimidine ABC transporter, ATP-binding protein
Locus tag: MED193_05504
Name: MED193_05504
Funciton: Hypothetical protein
Locus tag: MED193_05499
Name: pytB
Funciton: Pyrimidine ABC transporter, permease protein 1
Locus tag: MED193_05494
Name: MED193_05494
Funciton: Hypothetical protein
Locus tag: MED193_05489
Name: pytC
Funciton: Pyrimidine ABC transporter, permease protein 2
pydC-pydB-pytA-MED193_05504-pytB-MED193_05494-pytC -119 6.1 GTTTGACCAGTTGGTCAAAT MED193_05519