Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing pydP gene

Properties
Regulog: RutR - Rhodobacterales
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Pyrimidine utilization
Effector: Uracil
Phylum: Proteobacteria/alpha
Built upon 62 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Paracoccus denitrificans PD1222
Position: -225
Score: 5.14572
Sequence: TATTGACTGGTTGATAAAAT
Locus tag: Pden_1113
Name: pydC
Funciton: Beta-ureidopropionase (EC 3.5.1.6)
Locus tag: Pden_1112
Name: pydB
Funciton: phenylhydantoinase
Locus tag: Pden_1111
Name: pydP
Funciton: Pyrimidine permease in reductive pathway
pydC-pydB-pydP -225 5.1 TATTGACTGGTTGATAAAAT Pden_1113
© 2009-2020 RegPrecise