Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing hscB gene

Properties
Regulog: IscR - Moraxellaceae
Regulator type: Transcription factor
Regulator family: Rrf2
Regulation mode: activator (repressor)
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Phylum: Proteobacteria
Built upon 4 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Acinetobacter baumannii AB0057
Position: -66
Score: 8.15517
Sequence: AAACTTGACTATTTTAGTCGGGATT
Locus tag: AB57_1857
Name: iscR
Funciton: Iron-sulfur cluster regulator IscR
Locus tag: AB57_1856
Name: iscS
Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
Locus tag: AB57_1855
Name: iscU
Funciton: Iron-sulfur cluster assembly scaffold protein IscU
Locus tag: AB57_1854
Name: iscA
Funciton: Iron binding protein IscA for iron-sulfur cluster assembly
Locus tag: AB57_1853
Name: hscB
Funciton: Chaperone protein HscB
Locus tag: AB57_1852
Name: hscA
Funciton: Chaperone protein HscA
Locus tag: AB57_1851
Name: fdx
Funciton: ferredoxin, 2Fe-2S type, ISC system
iscR-iscS-iscU-iscA-hscB-hscA-fdx -66 8.2 AAACTTGACTATTTTAGTCGGGATT AB57_1857
Acinetobacter sp. ADP1
Position: -96
Score: 7.98869
Sequence: AAACTTGACTATTTTAGTCAGGATT
Locus tag: ACIAD1405
Name: iscR
Funciton: Iron-sulfur cluster regulator IscR
Locus tag: ACIAD1404
Name: iscS
Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
Locus tag: ACIAD1403
Name: iscU
Funciton: Iron-sulfur cluster assembly scaffold protein IscU
Locus tag: ACIAD1402
Name: iscA
Funciton: Iron binding protein IscA for iron-sulfur cluster assembly
Locus tag: ACIAD1400
Name: hscB
Funciton: Chaperone protein HscB
Locus tag: ACIAD1399
Name: hscA
Funciton: Chaperone protein HscA
Locus tag: ACIAD1398
Name: fdx
Funciton: ferredoxin, 2Fe-2S type, ISC system
iscR-iscS-iscU-iscA-hscB-hscA-fdx -96 8 AAACTTGACTATTTTAGTCAGGATT ACIAD1405
Psychrobacter arcticum 273-4
Position: -219
Score: 7.88673
Sequence: AATCTTGACTAAATTACTCGGGATT
Locus tag: Psyc_1476
Name: iscR
Funciton: Iron-sulfur cluster regulator IscR
Locus tag: Psyc_1477
Name: iscS
Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
Locus tag: Psyc_1478
Name: nifU
Funciton: Iron-sulfur cluster assembly scaffold protein IscU
Locus tag: Psyc_1479
Name: iscA
Funciton: Iron binding protein IscA for iron-sulfur cluster assembly
Locus tag: Psyc_1480
Name: hscB
Funciton: Chaperone protein HscB
Locus tag: Psyc_1481
Name: hscA
Funciton: Chaperone protein HscA
Locus tag: Psyc_1482
Name: fdx
Funciton: ferredoxin, 2Fe-2S type, ISC system
iscR-iscS-nifU-iscA-hscB-hscA-fdx -219 7.9 AATCTTGACTAAATTACTCGGGATT Psyc_1476
Psychrobacter sp. PRwf-1
Position: -75
Score: 8.05321
Sequence: AATCTTGACTAGTTTACTCGGGATT
Locus tag: PsycPRwf_1628
Name: iscR
Funciton: Iron-sulfur cluster regulator IscR
Locus tag: PsycPRwf_1629
Name: iscS
Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
Locus tag: PsycPRwf_1630
Name: null
Funciton: Iron-sulfur cluster assembly scaffold protein IscU
Locus tag: PsycPRwf_1631
Name: iscA
Funciton: Iron binding protein IscA for iron-sulfur cluster assembly
Locus tag: PsycPRwf_1632
Name: hscB
Funciton: Chaperone protein HscB
Locus tag: PsycPRwf_1633
Name: hscA
Funciton: Chaperone protein HscA
Locus tag: PsycPRwf_1634
Name: fdx
Funciton: ferredoxin, 2Fe-2S type, ISC system
iscR-iscS-PsycPRwf_1630-iscA-hscB-hscA-fdx -75 8.1 AATCTTGACTAGTTTACTCGGGATT PsycPRwf_1628