Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing cysT gene

Properties
Regulog: CymR - Bacillales
Regulator type: Transcription factor
Regulator family: Rrf2
Regulation mode: repressor
Biological process: Cysteine metabolism
Effector: O-acetyl-L-serine; CysK, cysteine synthetase
Phylum: Firmicutes
Built upon 65 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bacillus cereus ATCC 14579
Position: -158
Score: 5.41883
Sequence: AAATTCCAAGTTGACACATATGAATTA
Locus tag: BC1090
Name: subI
Funciton: Sulfate ABC transporter (sulfate-binding protein)
Locus tag: BC1091
Name: subI
Funciton: Sulfate ABC transporter (sulfate-binding protein)
Locus tag: BC1092
Name: cysT
Funciton: Sulfate ABC transporter (permease)
Locus tag: BC1093
Name: cysW
Funciton: Sulfate ABC transporter (permease)
Locus tag: BC1094
Name: cysA
Funciton: Sulfate ABC transporter (ATP-binding protein)
subI-subI-cysT-cysW-cysA -158 5.4 AAATTCCAAGTTGACACATATGAATTA BC1090
Bacillus halodurans C-125
Position: -142
Score: 4.82737
Sequence: TAAAACCCACTTGACAGATGGGGATTA
Position: -50
Score: 4.61818
Sequence: TAAAACAGACTTTTCCGATCTGTTTTA
Locus tag: BH3125
Name: BH3125
Funciton: Hypothetical protein
Locus tag: BH3126
Name: BH3126
Funciton: Hypothetical protein
Locus tag: BH3127
Name: subI
Funciton: Sulfate ABC transporter (sulfate-binding protein)
Locus tag: BH3128
Name: cysT
Funciton: Sulfate ABC transporter (permease)
Locus tag: BH3129
Name: cysW
Funciton: Sulfate ABC transporter (permease)
Locus tag: BH3130
Name: cysA
Funciton: Sulfate ABC transporter (ATP-binding protein)
BH3125-BH3126-subI-cysT-cysW-cysA -142 4.8 TAAAACCCACTTGACAGATGGGGATTA BH3125
-50 4.6 TAAAACAGACTTTTCCGATCTGTTTTA
Paenibacillus sp. JDR-2
Position: -96
Score: 4.68336
Sequence: CATAACCAACTAAACAGGTAGGAATAA
Locus tag: Pjdr2_4823
Name: subI
Funciton: Sulfate ABC transporter (sulfate-binding protein)
Locus tag: Pjdr2_4822
Name: cysT
Funciton: Sulfate ABC transporter (permease)
Locus tag: Pjdr2_4821
Name: cysW
Funciton: Sulfate ABC transporter (permease)
Locus tag: Pjdr2_4820
Name: null
Funciton: Hypothetical protein
subI-cysT-cysW-Pjdr2_4820 -96 4.7 CATAACCAACTAAACAGGTAGGAATAA Pjdr2_4823