Orthologous regulated operons containing PF06733 gene

Properties
Regulog:	LexA - Burkholderia
Regulator type:	Transcription factor
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Phylum:	Proteobacteria/beta

Built upon 75 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Burkholderia cepacia AMMD
Position: -30 Score: 5.39665 Sequence: ACCTGTACAAACGTACAGTG Locus tag: Bamb_3800 Name: PF08774 Funciton: Hypothetical protein, restriction endonuclease-like VRR-NUC domain Locus tag: Bamb_3801 Name: PF06733 Funciton: DinG family ATP-dependent helicase CPE1197
PF08774-PF06733	-30	5.4	ACCTGTACAAACGTACAGTG	Bamb_3800
Burkholderia phymatum STM815
Position: -37 Score: 5.58714 Sequence: GGCTGTATAAATATACAGTT Locus tag: Bphy_5308 Name: PF08774 Funciton: Hypothetical protein, restriction endonuclease-like VRR-NUC domain Locus tag: Bphy_5309 Name: PF06733 Funciton: DinG family ATP-dependent helicase CPE1197
PF08774-PF06733	-37	5.6	GGCTGTATAAATATACAGTT	Bphy_5308
Burkholderia sp. 383
Position: -30 Score: 5.49932 Sequence: ACCTGTACAAATGTACAGTG Locus tag: Bcep18194_B1631 Name: PF08774 Funciton: Hypothetical protein, restriction endonuclease-like VRR-NUC domain Locus tag: Bcep18194_B1630 Name: PF06733 Funciton: DinG family ATP-dependent helicase CPE1197
PF08774-PF06733	-30	5.5	ACCTGTACAAATGTACAGTG	Bcep18194_B1631
Burkholderia vietnamiensis G4
Position: -30 Score: 5.39665 Sequence: ACCTGTACAAACGTACAGTG Locus tag: Bcep1808_4916 Name: PF08774 Funciton: Hypothetical protein, restriction endonuclease-like VRR-NUC domain Locus tag: Bcep1808_4917 Name: PF06733 Funciton: DinG family ATP-dependent helicase CPE1197
PF08774-PF06733	-30	5.4	ACCTGTACAAACGTACAGTG	Bcep1808_4916
Burkholderia xenovorans LB400
Position: -34 Score: 5.8229 Sequence: CACTGTATATACATACAGGT Locus tag: Bxe_B1179 Name: PF08774 Funciton: Hypothetical protein, restriction endonuclease-like VRR-NUC domain Locus tag: Bxe_B1180 Name: PF06733 Funciton: DinG family ATP-dependent helicase CPE1197
PF08774-PF06733	-34	5.8	CACTGTATATACATACAGGT	Bxe_B1179