Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing PF08774 gene

Properties
Regulog: LexA - Burkholderia
Regulator type: Transcription factor
Regulator family: LexA
Regulation mode: repressor
Biological process: SOS response
Effector: DNA damage
Phylum: Proteobacteria/beta
Built upon 75 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Burkholderia cepacia AMMD
Position: -30
Score: 5.39665
Sequence: ACCTGTACAAACGTACAGTG
Locus tag: Bamb_3800
Name: PF08774
Funciton: Hypothetical protein, restriction endonuclease-like VRR-NUC domain
Locus tag: Bamb_3801
Name: PF06733
Funciton: DinG family ATP-dependent helicase CPE1197
PF08774-PF06733 -30 5.4 ACCTGTACAAACGTACAGTG Bamb_3800
Burkholderia phymatum STM815
Position: -37
Score: 5.58714
Sequence: GGCTGTATAAATATACAGTT
Locus tag: Bphy_5308
Name: PF08774
Funciton: Hypothetical protein, restriction endonuclease-like VRR-NUC domain
Locus tag: Bphy_5309
Name: PF06733
Funciton: DinG family ATP-dependent helicase CPE1197
PF08774-PF06733 -37 5.6 GGCTGTATAAATATACAGTT Bphy_5308
Burkholderia sp. 383
Position: -30
Score: 5.49932
Sequence: ACCTGTACAAATGTACAGTG
Locus tag: Bcep18194_B1631
Name: PF08774
Funciton: Hypothetical protein, restriction endonuclease-like VRR-NUC domain
Locus tag: Bcep18194_B1630
Name: PF06733
Funciton: DinG family ATP-dependent helicase CPE1197
PF08774-PF06733 -30 5.5 ACCTGTACAAATGTACAGTG Bcep18194_B1631
Burkholderia vietnamiensis G4
Position: -30
Score: 5.39665
Sequence: ACCTGTACAAACGTACAGTG
Locus tag: Bcep1808_4916
Name: PF08774
Funciton: Hypothetical protein, restriction endonuclease-like VRR-NUC domain
Locus tag: Bcep1808_4917
Name: PF06733
Funciton: DinG family ATP-dependent helicase CPE1197
PF08774-PF06733 -30 5.4 ACCTGTACAAACGTACAGTG Bcep1808_4916
Burkholderia xenovorans LB400
Position: -34
Score: 5.8229
Sequence: CACTGTATATACATACAGGT
Locus tag: Bxe_B1179
Name: PF08774
Funciton: Hypothetical protein, restriction endonuclease-like VRR-NUC domain
Locus tag: Bxe_B1180
Name: PF06733
Funciton: DinG family ATP-dependent helicase CPE1197
PF08774-PF06733 -34 5.8 CACTGTATATACATACAGGT Bxe_B1179