Orthologous regulated operons containing mntC gene

Properties
Regulog:	MntR - Nocardiaceae
Regulator type:	Transcription factor
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Phylum:	Actinobacteria

Built upon 10 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Nocardia farcinica IFM 10152
Position: -35 Score: 5.57012 Sequence: AAAGTTAGGGCGTCCGAAAATT Locus tag: nfa24340 Name: mntC Funciton: Manganese ABC transporter, periplasmic-binding protein Locus tag: nfa24350 Name: mntA Funciton: Manganese ABC transporter, ATP-binding protein Locus tag: nfa24360 Name: mntB Funciton: Manganese ABC transporter, inner membrane permease protein
mntC-mntA-mntB	-35	5.6	AAAGTTAGGGCGTCCGAAAATT	nfa24340
Rhodococcus erythropolis PR4
Position: -55 Score: 5.19922 Sequence: ATTGTTCGGCTATACGAACTTG Locus tag: RER_59770 Name: mntC Funciton: Manganese ABC transporter, periplasmic-binding protein Locus tag: RER_59760 Name: mntA Funciton: Manganese ABC transporter, ATP-binding protein Locus tag: RER_59750 Name: mntB Funciton: Manganese ABC transporter, inner membrane permease protein
mntC-mntA-mntB	-55	5.2	ATTGTTCGGCTATACGAACTTG	RER_59770
Rhodococcus opacus B4
Position: -52 Score: 5.47351 Sequence: TGGTTTCGGTGAACCGAACATT Locus tag: ROP_70570 Name: mntC Funciton: Manganese ABC transporter, periplasmic-binding protein Locus tag: ROP_70560 Name: mntA Funciton: Manganese ABC transporter, ATP-binding protein Locus tag: ROP_70550 Name: mntB Funciton: Manganese ABC transporter, inner membrane permease protein
mntC-mntA-mntB	-52	5.5	TGGTTTCGGTGAACCGAACATT	ROP_70570
Rhodococcus sp. RHA1
Position: -60 Score: 5.45838 Sequence: TGGTTTCGGCAAGCCGAACATT Locus tag: RHA1_ro07271 Name: mntC Funciton: Manganese ABC transporter, periplasmic-binding protein Locus tag: RHA1_ro07270 Name: mntA Funciton: Manganese ABC transporter, ATP-binding protein Locus tag: RHA1_ro07269 Name: mntB Funciton: Manganese ABC transporter, inner membrane permease protein
mntC-mntA-mntB	-60	5.5	TGGTTTCGGCAAGCCGAACATT	RHA1_ro07271