Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing uxuQ gene

Properties
Regulog: GulR - Rhizobiales
Regulator type: Transcription factor
Regulator family: LysR
Regulation mode:
Biological process: Glucarate utilization; Galactarate utilization
Effector:
Phylum: Proteobacteria/Alpha
Built upon 13 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bradyrhizobium sp. BTAi1
Position: -183
Score: 6.22088
Sequence: ATCGATGCAAGTCTTGCATTGAT
Locus tag: BBta_0128
Name: uxuP
Funciton: Predicted glucuronate /galacturonate TRAP-type transporter, periplasmic component
Locus tag: BBta_0129
Name: uxuQ
Funciton: Predicted glucuronate /galacturonate TRAP-type transporter, small permease component
Locus tag: BBta_0130
Name: uxuM
Funciton: Predicted glucuronate /galacturonate TRAP-type transporter, large permease component
uxuP-uxuQ-uxuM -183 6.2 ATCGATGCAAGTCTTGCATTGAT BBta_0128