Orthologous regulated operons containing h16_A2979 gene

Properties
Regulog:	MlnR - Ralstonia
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Malonate metabolism
Effector:
Phylum:	Proteobacteria/Beta

Built upon 4 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Cupriavidus taiwanensis
Position: -71 Score: 6.70563 Sequence: TAATTCATAATTATGAATTA Locus tag: RALTA_A2456 Name: mlnR Funciton: Transcriptional regulator of malonate metabolism, GntR family Locus tag: RALTA_A2455 Name: matA Funciton: Malonyl-CoA decarboxylase Locus tag: RALTA_A2454 Name: h16_A2980 Funciton: putative exported protein Locus tag: RALTA_A2453 Name: h16_A2979 Funciton: methylmalonyl CoA decarboxylase/enoyl-CoA hydratase/isomerase Locus tag: RALTA_A2452 Name: matB Funciton: Malonyl-CoA ligase (EC 6.2.1.3)
mlnR-matA-h16_A2980-h16_A2979-matB	-71	6.7	TAATTCATAATTATGAATTA	RALTA_A2456
Ralstonia eutropha H16
Position: -102 Score: 6.5846 Sequence: TAATCCATAATTATGAATTA Locus tag: H16_A2982 Name: mlnR Funciton: Transcriptional regulator of malonate metabolism, GntR family Locus tag: H16_A2981 Name: matA Funciton: Malonyl-CoA decarboxylase Locus tag: H16_A2980 Name: h16_A2980 Funciton: putative exported protein Locus tag: H16_A2979 Name: h16_A2979 Funciton: methylmalonyl CoA decarboxylase/enoyl-CoA hydratase/isomerase Locus tag: H16_A2978 Name: matB Funciton: Malonyl-CoA ligase (EC 6.2.1.3)
mlnR-matA-h16_A2980-h16_A2979-matB	-102	6.6	TAATCCATAATTATGAATTA	H16_A2982
Ralstonia eutropha JMP134
Position: -77 Score: 6.50109 Sequence: TCATCCATAATTATGAATTA Locus tag: Reut_A0644 Name: mlnR Funciton: Transcriptional regulator of malonate metabolism, GntR family Locus tag: Reut_A0645 Name: matA Funciton: Malonyl-CoA decarboxylase Locus tag: Reut_A0646 Name: h16_A2980 Funciton: putative exported protein Locus tag: Reut_A0647 Name: h16_A2979 Funciton: methylmalonyl CoA decarboxylase/enoyl-CoA hydratase/isomerase Locus tag: Reut_A0648 Name: matB Funciton: Malonyl-CoA ligase (EC 6.2.1.3)
mlnR-matA-h16_A2980-h16_A2979-matB	-77	6.5	TCATCCATAATTATGAATTA	Reut_A0644
Ralstonia metallidurans CH34
Position: -63 Score: 6.65499 Sequence: TTATTCATAATTATGAATTA Locus tag: Rmet_2798 Name: mlnR Funciton: Transcriptional regulator of malonate metabolism, GntR family Locus tag: Rmet_2797 Name: matA Funciton: Malonyl-CoA decarboxylase Locus tag: Rmet_2796 Name: h16_A2980 Funciton: putative exported protein Locus tag: Rmet_2795 Name: h16_A2979 Funciton: methylmalonyl CoA decarboxylase/enoyl-CoA hydratase/isomerase Locus tag: Rmet_2794 Name: matB Funciton: Malonyl-CoA ligase (EC 6.2.1.3)
mlnR-matA-h16_A2980-h16_A2979-matB	-63	6.7	TTATTCATAATTATGAATTA	Rmet_2798