Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing hmuT gene

Properties
Regulog: Fur - Alteromonadales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor (activator)
Biological process: Iron homeostasis
Effector: Iron ion, (Fe2+)
Phylum: Proteobacteria/Gamma
Built upon 142 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Idiomarina baltica OS145
Position: -81
Score: 5.39068
Sequence: AAACGAAAACTATTTGCATTT
Locus tag: OS145_06449
Name: hmuT
Funciton: Hemin ABC transporter, periplasmic component
Locus tag: OS145_06454
Name: hmuU
Funciton: Hemin ABC transporter, permease protein
Locus tag: OS145_06459
Name: hmuV
Funciton: Hemin ABC transporter, ATP-binding protein
Locus tag: OS145_06464
Name: COG0748
Funciton: Putative heme iron utilization protein
hmuT-hmuU-hmuV-COG0748 -81 5.4 AAACGAAAACTATTTGCATTT OS145_06449
Idiomarina loihiensis L2TR
Position: -87
Score: 5.53221
Sequence: AAACGAAAATGATTTGCATTT
Locus tag: IL0113
Name: hmuT
Funciton: Hemin ABC transporter, periplasmic component
Locus tag: IL0114
Name: hmuU
Funciton: Hemin ABC transporter, permease protein
Locus tag: IL0115
Name: hmuV
Funciton: Hemin ABC transporter, ATP-binding protein
Locus tag: IL0116
Name: COG0748
Funciton: Putative heme iron utilization protein
hmuT-hmuU-hmuV-COG0748 -87 5.5 AAACGAAAATGATTTGCATTT IL0113
Pseudoalteromonas atlantica T6c
Position: -66
Score: 5.59969
Sequence: AAATGATAACGATTACTATTT
Locus tag: Patl_1486
Name: COG4771
Funciton: Outer membrane receptor for ferrienterochelin, TonB-dependent
Locus tag: Patl_1487
Name: null
Funciton: hypothetical protein
Locus tag: Patl_1488
Name: hmuT
Funciton: Hemin ABC transporter, periplasmic component
Locus tag: Patl_1489
Name: hmuU
Funciton: Hemin ABC transporter, permease protein
Locus tag: Patl_1490
Name: hmuV
Funciton: Hemin ABC transporter, ATP-binding protein
Locus tag: Patl_1491
Name: COG0748
Funciton: Putative heme iron utilization protein
COG4771-Patl_1487-hmuT-hmuU-hmuV-COG0748 -66 5.6 AAATGATAACGATTACTATTT Patl_1486
Pseudoalteromonas tunicata D2
Position: -76
Score: 5.94187
Sequence: TAATGAGAAGTATTATCATTT
Locus tag: PTD2_10203
Name: hmuT
Funciton: Hemin ABC transporter, periplasmic component
Locus tag: PTD2_10198
Name: hmuU
Funciton: Hemin ABC transporter, permease protein
Locus tag: PTD2_10193
Name: hmuV
Funciton: Hemin ABC transporter, ATP-binding protein
hmuT-hmuU-hmuV -76 5.9 TAATGAGAAGTATTATCATTT PTD2_10203