Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Patl_1487 gene

Properties
Regulog: Fur - Alteromonadales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor (activator)
Biological process: Iron homeostasis
Effector: Iron ion, (Fe2+)
Phylum: Proteobacteria/Gamma
Built upon 142 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Pseudoalteromonas atlantica T6c
Position: -66
Score: 5.59969
Sequence: AAATGATAACGATTACTATTT
Locus tag: Patl_1486
Name: COG4771
Funciton: Outer membrane receptor for ferrienterochelin, TonB-dependent
Locus tag: Patl_1487
Name: null
Funciton: hypothetical protein
Locus tag: Patl_1488
Name: hmuT
Funciton: Hemin ABC transporter, periplasmic component
Locus tag: Patl_1489
Name: hmuU
Funciton: Hemin ABC transporter, permease protein
Locus tag: Patl_1490
Name: hmuV
Funciton: Hemin ABC transporter, ATP-binding protein
Locus tag: Patl_1491
Name: COG0748
Funciton: Putative heme iron utilization protein
COG4771-Patl_1487-hmuT-hmuU-hmuV-COG0748 -66 5.6 AAATGATAACGATTACTATTT Patl_1486
© 2009-2020 RegPrecise