Orthologous regulated operons containing nrtR gene

Properties
Regulog:	NrtR - Frankineae/Propionibacterineae/Pseudonocardiaceae
Regulator type:	Transcription factor
Regulator family:	NrtR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Adenosine diphosphate ribose
Phylum:	Actinobacteria

Built upon 6 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Frankia sp. EAN1pec
Position: -79 Score: 6.1613 Sequence: TTATCGTCGAACTGACGATAA Position: -33 Score: 4.65295 Sequence: TTCTCGTCAACCTGACGAGAT Locus tag: Franean1_6653 Name: nrtR Funciton: Nudix-related transcriptional regulator NrtR
nrtR	-79	6.2	TTATCGTCGAACTGACGATAA	Franean1_6653
	-33	4.7	TTCTCGTCAACCTGACGAGAT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --