Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing phnF gene

Properties
Regulog: PhnF - Comamonadaceae
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Phosphonate utilization
Effector:
Phylum: Proteobacteria
Built upon 2 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Methylibium petroleiphilum PM1
Position: -28
Score: 4.37072
Sequence: CCCAGATATCTAGACATCTGGA
Locus tag: Mpe_B0420
Name: phnF
Funciton: phophonate C-P lyase system transcriptional regulator PhnF, GntR family
Locus tag: Mpe_B0421
Name: phnD
Funciton: Phosphonate ABC transporter phosphate-binding periplasmic component (TC 3.A.1.9.1)
Locus tag: Mpe_B0422
Name: phnC
Funciton: Phosphonate ABC transporter ATP-binding protein (TC 3.A.1.9.1)
phnF-phnD-phnC -28 4.4 CCCAGATATCTAGACATCTGGA Mpe_B0420
© 2009-2020 RegPrecise