Orthologous regulated operons containing merT gene

Properties
Regulog:	MerR - Various betaproteobacteria
Regulator type:	Transcription factor
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Mercury resistance
Effector:	Mercury ion, (Hg2+)
Phylum:	Proteobacteria/Beta

Built upon 2 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Nitrosomonas europaea ATCC 19718
Position: -63 Score: 6.1447 Sequence: ACTCCGTACATGACTACGGAAG Locus tag: NE0842 Name: merT Funciton: Mercury uptake inner membane protein Locus tag: NE0841 Name: merP Funciton: Periplasmic mercury (+2) binding protein Locus tag: NE0840 Name: merC Funciton: Mercury uptake inner membane protein Locus tag: NE0839 Name: merA Funciton: Mercuric ion reductase (EC 1.16.1.1) Locus tag: NE0838 Name: merD Funciton: Mercuric resistance operon coregulator
merT-merP-merC-merA-merD	-63	6.1	ACTCCGTACATGACTACGGAAG	NE0842
Thiobacillus denitrificans
Position: -52 Score: 6.20954 Sequence: ACTCCGTACATAACTACGGAAA Locus tag: Tbd_1339 Name: merT Funciton: Mercury uptake inner membane protein Locus tag: Tbd_1340 Name: merP Funciton: Periplasmic mercury (+2) binding protein Locus tag: Tbd_1341 Name: merA Funciton: Mercuric ion reductase (EC 1.16.1.1)
merT-merP-merA	-52	6.2	ACTCCGTACATAACTACGGAAA	Tbd_1339

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --