Orthologous regulated operons containing Jann_3937 gene

Properties
Regulog:	AfrR - Rhodobacterales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	1,5-Anhydro-d-Fructose utilization
Effector:
Phylum:	Proteobacteria/Alpha

Built upon 3 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Jannaschia sp. CCS1
Position: -58 Score: 5.54923 Sequence: ATTGTGGAACGTTCCAATTA Position: -33 Score: 5.75692 Sequence: AAATCGGAACGTTCCAATTT Locus tag: Jann_3940 Name: afr Funciton: 1,5-anhydro-D-fructose reductase EC=1.1.1.292 Locus tag: Jann_3939 Name: null Funciton: coenzyme A transferase Locus tag: Jann_3938 Name: null Funciton: enoyl-CoA hydratase Locus tag: Jann_3937 Name: null Funciton: Betaine-aldehyde dehydrogenase EC=1.2.1.-
afr-Jann_3939-Jann_3938-Jann_3937	-58	5.5	ATTGTGGAACGTTCCAATTA	Jann_3940
	-33	5.8	AAATCGGAACGTTCCAATTT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --