Orthologous regulated operons containing sdh gene

Properties
Regulog:	AfrR - Rhodobacterales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	1,5-Anhydro-d-Fructose utilization
Effector:
Phylum:	Proteobacteria/Alpha

Built upon 3 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Jannaschia sp. CCS1
Position: -35 Score: 5.38035 Sequence: GAATTGGAACGTTCCAGAAG Locus tag: Jann_3931 Name: null Funciton: FAD dependent oxidoreductase Locus tag: Jann_3930 Name: null Funciton: short-chain dehydrogenase/reductase SDR Locus tag: Jann_3929 Name: sdh Funciton: L-sorbose 1-dehydrogenase EC=1.1.99.32 Locus tag: Jann_3928 Name: null Funciton: hypothetical protein Locus tag: Jann_3927 Name: afrR Funciton: Transcriptional regulator for 1,5-Anhydro-d-Fructose utilization, LacI family Locus tag: Jann_3926 Name: null Funciton: Hydroxypyruvate reductase Locus tag: Jann_3925 Name: null Funciton: Stress responsive alpha-beta Locus tag: Jann_3924 Name: null Funciton: hypothetical protein
Jann_3931-Jann_3930-sdh-Jann_3928-afrR-Jann_3926-Jann_3925-Jann_3924	-35	5.4	GAATTGGAACGTTCCAGAAG	Jann_3931

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --