Orthologous regulated operons containing sacF gene

Properties
Regulog:	ScrR - Bacillales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sucrose utilization
Effector:	Sucrose
Phylum:	Firmicutes

Built upon 7 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Bacillus clausii KSM-K16
Position: -83 Score: 7.58808 Sequence: TATGTCAACCGGTTGACATA Locus tag: ABC3119 Name: sacH Funciton: Predicted fructose oligosaccharide ABC transporter, membrane-spanning permease protein Locus tag: ABC3118 Name: sacG Funciton: Predicted fructose oligosaccharide ABC transporter, membrane-spanning permease protein 2 Locus tag: ABC3117 Name: sacF Funciton: Predicted fructose oligosaccharide ABC transporter, substrate-binding protein Locus tag: ABC3116 Name: sacC Funciton: Levanase (EC 3.2.1.65) Locus tag: ABC3115 Name: cscA Funciton: Sucrose hydrolase (EC 3.2.1.26)
sacH-sacG-sacF-sacC-cscA	-83	7.6	TATGTCAACCGGTTGACATA	ABC3119
Bacillus licheniformis DSM 13
Position: -97 Score: 7.58808 Sequence: TATGTCAACCGGTTGACATA Locus tag: BLi04182 Name: sacF Funciton: Predicted fructose oligosaccharide ABC transporter, substrate-binding protein Locus tag: BLi04181 Name: sacH Funciton: Predicted fructose oligosaccharide ABC transporter, membrane-spanning permease protein Locus tag: BLi04180 Name: sacG Funciton: Predicted fructose oligosaccharide ABC transporter, membrane-spanning permease protein 2 Locus tag: BLi04179 Name: cscB Funciton: Sucrose permease, major facilitator superfamily Locus tag: BLi04178 Name: cscA Funciton: Sucrose hydrolase (EC 3.2.1.26)
sacF-sacH-sacG-cscB-cscA	-97	7.6	TATGTCAACCGGTTGACATA	BLi04182
Paenibacillus sp. JDR-2
Position: -103 Score: 7.31438 Sequence: TATGTCATCCGGTTGACATA Locus tag: Pjdr2_5213 Name: sacH Funciton: Predicted fructose oligosaccharide ABC transporter, membrane-spanning permease protein Locus tag: Pjdr2_5214 Name: sacG Funciton: Predicted fructose oligosaccharide ABC transporter, membrane-spanning permease protein 2 Locus tag: Pjdr2_5215 Name: sacF Funciton: Predicted fructose oligosaccharide ABC transporter, substrate-binding protein Locus tag: Pjdr2_5216 Name: sacC Funciton: Levanase (EC 3.2.1.65)
sacH-sacG-sacF-sacC	-103	7.3	TATGTCATCCGGTTGACATA	Pjdr2_5213