Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Mflv_3560 gene

Properties
Regulog: Zur - Mycobacteriaceae
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Actinobacteria
Built upon 70 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Mycobacterium flavescens PYR-GCK
Position: -39
Score: 6.051
Sequence: TTTTGACAATGATTTTCATTA
Locus tag: Mflv_3560
Name: Mflv_3560
Funciton: putative secreted protein
Mflv_3560 -39 6.1 TTTTGACAATGATTTTCATTA Mflv_3560
Mycobacterium sp. JLS
Position: -90
Score: 6.21096
Sequence: TGTTGAAAATGATTTTCATTA
Locus tag: Mjls_5110
Name: znuB2
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Locus tag: Mjls_5109
Name: znuB2
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Locus tag: Mjls_5108
Name: znuA2
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: Mjls_5107
Name: Mflv_3560
Funciton: putative secreted protein
znuB2-znuB2-znuA2-Mflv_3560 -90 6.2 TGTTGAAAATGATTTTCATTA Mjls_5110
Mycobacterium vanbaalenii PYR-1
Position: -39
Score: 6.37103
Sequence: TATTGAAAATGATTGTCATTA
Locus tag: Mvan_5325
Name: znuB2
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Locus tag: Mvan_5324
Name: znuA2
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: Mvan_5323
Name: Mflv_3560
Funciton: putative secreted protein
znuB2-znuA2-Mflv_3560 -39 6.4 TATTGAAAATGATTGTCATTA Mvan_5325
© 2009-2020 RegPrecise