Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Sama_2226 gene

Properties
Regulog: Crp - Shewanellaceae
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: repressor (activator)
Biological process: Carbon catabolism
Effector: Cyclic 3',5'-AMP
Phylum: Proteobacteria
Built upon 2713 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Shewanella amazonensis SB2B
Position: -304
Score: 4.45896
Sequence: TTTTGTTAACTGCCTCACGTTT
Locus tag: Sama_2223
Name: null
Funciton: UTP--glucose-1-phosphate uridylyltransferase (EC 2.7.7.9)
Locus tag: Sama_2224
Name: null
Funciton: UDP-glucose 4-epimerase (EC 5.1.3.2)
Locus tag: Sama_2225
Name: null
Funciton: ferredoxin-type protein NapF
Locus tag: Sama_2226
Name: null
Funciton: Protein of unknown function DUF583
Locus tag: Sama_2227
Name: null
Funciton: Transcriptional regulator, LysR family
Locus tag: Sama_2228
Name: mtrF
Funciton: decaheme cytochrome c MtrF
Sama_2223-Sama_2224-Sama_2225-Sama_2226-Sama_2227-mtrF -304 4.5 TTTTGTTAACTGCCTCACGTTT Sama_2223
© 2009-2020 RegPrecise