Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing cg2184 gene

Properties
Regulog: AmtR - Corynebacteriaceae
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Nitrogen metabolism
Effector: GlnK-AMP, signal transduction protein
Phylum: Actinobacteria
Built upon 42 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Corynebacterium diphtheriae NCTC 13129
Position: -162
Score: 4.01277
Sequence: TAAAACTATTATTTGATAGTTTTA
Locus tag: DIP0956
Name: cg2181
Funciton: Predicted ABC transporter, substrate-binding protein
Locus tag: DIP0957
Name: cg2182
Funciton: Predicted ABC transporter, permease protein 1
Locus tag: DIP0958
Name: cg2183
Funciton: Predicted ABC transporter, permease protein 2
Locus tag: DIP0959
Name: cg2184
Funciton: Predicted ABC transporter, ATP-binding protein
cg2181-cg2182-cg2183-cg2184 -162 4 TAAAACTATTATTTGATAGTTTTA DIP0956
Corynebacterium glutamicum ATCC 13032
Position: -218
Score: 5.73849
Sequence: AATTTCTATCAAACTATAGAAAGA
Locus tag: cg2181
Name: cg2181
Funciton: Predicted ABC transporter, substrate-binding protein
Locus tag: cg2182
Name: cg2182
Funciton: Predicted ABC transporter, permease protein 1
Locus tag: cg2183
Name: cg2183
Funciton: Predicted ABC transporter, permease protein 2
Locus tag: cg2184
Name: cg2184
Funciton: Predicted ABC transporter, ATP-binding protein
cg2181-cg2182-cg2183-cg2184 -218 5.7 AATTTCTATCAAACTATAGAAAGA cg2181