Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing PF10986 gene

Properties
Regulog: Zur - Various betaproteobacteria
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria
Built upon 10 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Methylobacillus flagellatus KT
Position: -11
Score: 6.39724
Sequence: AATATGCCACAATGTTGCATTAC
Locus tag: Mfla_0708
Name: omr
Funciton: Predicted zinc-related TonB-dependent outer membrane transporter
Locus tag: Mfla_0707
Name: zip
Funciton: Zinc transporter, ZIP family
Locus tag: Mfla_0706
Name: PF10986
Funciton: Predicted ABC transport system, substrate-binding protein
Locus tag: Mfla_0705
Name: COG1124
Funciton: Predicted ABC transport system, ATP-binding protein
Locus tag: Mfla_0704
Name: COG0577
Funciton: Predicted ABC transport system, permease protein
Locus tag: Mfla_0703
Name: PF11736
Funciton: Lipoprotein, putative
omr-zip-PF10986-COG1124-COG0577-PF11736 -11 6.4 AATATGCCACAATGTTGCATTAC Mfla_0708
Thauera sp. MZ1T
Position: -99
Score: 6.36925
Sequence: TTGATGCAACATTGTAGCATTAG
Locus tag: Tmz1t_3495
Name: PF10986
Funciton: Predicted ABC transport system, substrate-binding protein
Locus tag: Tmz1t_3494
Name: COG1124
Funciton: Predicted ABC transport system, ATP-binding protein
Locus tag: Tmz1t_3493
Name: COG0577
Funciton: Predicted ABC transport system, permease protein
Locus tag: Tmz1t_3492
Name: PF11736
Funciton: Lipoprotein, putative
PF10986-COG1124-COG0577-PF11736 -99 6.4 TTGATGCAACATTGTAGCATTAG Tmz1t_3495