Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator HrcA in Desulfovibrionales

Properties
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Regulog: HrcA - Desulfovibrionales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Desulfovibrio vulgaris Hildenborough
DVU1977 groS -69 6.6 CTGGCACTCATCACAAGAGAGTGCCAA
Desulfovibrio vulgaris str. Miyazaki F
DvMF_3063 groS -72 6.1 TTGGCACTCGCACCCCGCGAGTGCCAA
Desulfovibrio desulfuricans G20
Dde_2474 groS -69 7.2 TTGGCACTCGCGTGAAGAGAGTGCTAA
Desulfovibrio magneticus RS-1
DMR_02720 groS -65 5.9 CTGGCACTCGCCGCAAGCGAGTGCCAG
DMR_17390 hrcA -40 5.8 TTGGCACTCGAAAGCCACGAGTGCCAA
Desulfomicrobium baculatum DSM 4028
Dbac_2625 groS -76 5.9 TTGGCACTCCCCATTGCCGAGCGCCAA
Desulfohalobium retbaense DSM 5692
Dret_2175 groS -69 6.8 TTAGCACTCCCCTGACAGGAGTGCTAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD