Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator DVU2423 in Desulfovibrionales

Properties
Regulator family: HxlR
Regulation mode:
Biological process: Nitrogen metabolism
Effector:
Regulog: DVU2423 - Desulfovibrionales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Desulfovibrio vulgaris Hildenborough
DVU2423 null -19 5.3 TTGTACCCTAGAGGATACCA
DVU2422 DVU2422 -102 5.3 TGGTATCCTCTAGGGTACAA
Desulfovibrio vulgaris str. Miyazaki F
DvMF_2974 null -73 5 TAGTATCCTGCGGCATACCA
DvMF_2975 DVU2422 -235 5 TGGTATGCCGCAGGATACTA
Desulfovibrio magneticus RS-1
DMR_35240 null -37 5 TAGTATCCTTTTGGATACCA
DMR_35230 DVU2422 -106 5 TGGTATCCAAAAGGATACTA
Desulfomicrobium baculatum DSM 4028
Dbac_0456 null -35 4.4 GTCTATAATGTACGGTACAC
Dbac_0455 null -98 4.4 GTGTACCGTACATTATAGAC
Desulfohalobium retbaense DSM 5692
Dret_0703 null -143 4.1 GTGTGCCCTGCTTTGCATAC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD