Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator DVU0030 in Desulfovibrionales

Properties
Regulator family: GntR/MocR
Regulation mode:
Biological process: Amino acid transport
Effector:
Regulog: DVU0030 - Desulfovibrionales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Desulfovibrio vulgaris Hildenborough
DVU0031 null -431 5.2 TAAAAACTGTATCTGTCATCA
DVU0030 null -40 5.2 TGATGACAGATACAGTTTTTA
Desulfovibrio vulgaris str. Miyazaki F
DvMF_2174 null -124 4.4 GTTTGACTGTATCTGTTCAGG
DvMF_2175 null -196 4.4 CCTGAACAGATACAGTCAAAC
Desulfovibrio desulfuricans G20
Dde_0158 null -109 4.6 TGAAAATTGTATCTGTGTTTG
Dde_0158 null -127 5.6 TAAAAACTGTATCTGTTCTGA
Dde_0157 null -44 5.6 TCAGAACAGATACAGTTTTTA
Dde_0157 null -62 4.6 CAAACACAGATACAATTTTCA
Desulfovibrio salexigens DSM 2638
Desal_3216 null -93 4.9 TAAAATCTGTATCTGTACTGA
Desal_3216 null -118 4.9 CTAAAACTGTTACGGTTCATA
Desal_3215 null -39 4.9 TATGAACCGTAACAGTTTTAG
Desal_3215 null -64 4.9 TCAGTACAGATACAGATTTTA
Desulfovibrio magneticus RS-1
DMR_35550 null -71 4.7 CCATCACAGACACAGTTTTCA
Desulfomicrobium baculatum DSM 4028
Dbac_3053 null -64 4.4 CGCAAACTGTATCTGTACCGC
Dbac_3052 null -536 4.4 GCGGTACAGATACAGTTTGCG
Desulfohalobium retbaense DSM 5692
Dret_1470 null -372 4.5 TCGAAATTGTATCTGTCTCAG
Dret_1471 null -40 4.5 CTGAGACAGATACAATTTCGA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD