Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Zur in Bacillales

Properties
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Bacillales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bacillus subtilis subsp. subtilis str. 168
BSU26830 zinT -42 6.5 TAAATCGTAATGTTTTCGATTTA
BSU03360 yciC -37 5.8 TAAATCGTAATCATTCTATTTTA
BSU08880 rpsN2 -40 6.6 TAAATCGTAACAATTTCGATTTA
BSU30700 rpmE2 -39 7 TAAAACGTAATTATTACGATTTA
BSU02850 adcA -52 5.8 AAAATCGTTATCATTTTGATTTA
BSU02850 adcA -92 5.6 CAAAACGTAATGACTTCGGTTTA
BSU03340 folE2 -44 6.7 TAAATAGTAATTATTACGATTTG
Bacillus amyloliquefaciens FZB42
RBAM_003550 yciC -38 5.7 TAAATCGTAATCATTCTATTTTG
RBAM_003550 yciC -103 6.6 TAAATAGTAACGATTACGATTTA
RBAM_009150 rpsN2 -37 6.7 CAAAACGTAATTATTACGATTTG
RBAM_022140 rpmGA1 -40 6.8 TAAAACGTAATAATTACGATTTG
RBAM_027710 rpmE2 -39 6.8 TAAAACGTAATTATTACGATTTG
RBAM_003110 adcA -42 5.5 GAAATCGTCATCATTCTGATTTA
RBAM_003110 adcA -105 5.8 CAAAACGTAATTACTTCGTTTTA
Bacillus pumilus SAFR-032
BPUM_2243 znuC -46 5.4 TAAATCGTAATCATTCTTTTTAT
BPUM_3311 yciC -69 6.6 CAAATCGTAATCATTACTTTTTA
BPUM_3310 rpmGA1 -42 6.5 CAAATCGTAACCATTACGAATTA
BPUM_2709 rpmE2 -44 6.5 TAAAGCGTAATGATTACGTTTTG
BPUM_2707 ytiB -151 6.5 TGTATCGTAATAATTACGATTTG
BPUM_2707 ytiB -188 6.1 TAGATAGAAATGATTACGATTTA
Bacillus licheniformis DSM 13
BLi03212 yciC -38 6.2 CAAATCGAAACAATTACGTTTTA
BLi00765 yciC -46 7 TAAATCGTAATAATTACGATTTG
BLi01970 sufE2 -98 6.8 TAAATCGTAATTATTATGATTTA
BLi00952 rpsN2 -44 6.7 TAAATCGTAATCATTACGCTTTG
BLi02553 rpmGA1 -37 6.6 TAAAGCGTAATGATTACGTTTTA
BLi03211 ytiB -111 6.2 TAAAACGTAATTGTTTCGATTTG
BLi03214 rpmE2 -39 6.6 TAAAACGTAATTATTACGTTTTG
BLi01934 null -41 5.9 CAAATCGGAATAATTCTGTTTTA
BLi01934 null -245 6.7 CAAATCGTAATAATTACGTTTTG
BLi00762 folE2 -44 6 TAAATAGGAACTATTTCGATTTA
BLi00762 folE2 -120 5.9 CTAAACGAAATCATTTCGATTTA
Anoxybacillus flavithermus WK1
Aflv_0867 znuC -36 5.7 TGAATCGGAATCATTTTGAATTA
Aflv_0397 yciC -40 7 TAAATCGTAATGATTACGTTTTA
Aflv_1438 rpmGA1 -45 6.3 CAAAACGTAATGATTACTATTTT
Geobacillus kaustophilus HTA426
GK2471 znuC -39 5.8 CAAATCGGAATGATTCTGAATTA
Bacillus cereus ATCC 14579
BC4279 znuC -39 6 TAAATCGGAATCATTCTGAATTA
BC1705 yciC -39 7 TAAAACGTAATCATTACGATTTA
BC1705 yciC -93 6.9 TAAATCGTAATCATTATGATTTA
BC4339 rpmGA1 -55 7 TAAATCGTAATCATTACGTTTTA
BC1926 null -68 6.7 TAAATCGTAATTATTACGCTTTG
Bacillus halodurans C-125
BH1394 znuC -72 5 TAAATCGGAATGATTCTTAATAT
BH1790 yciC -54 5.5 CAAATCGTAATGATAACTTTTAT
BH1790 yciC -195 6.7 CAAAGCGTAATTATTACGATTTA
BH0366 BH0366 -40 6.6 TAAATAGGAATTATTACGATTTA
BH0998 folE2 -41 6.2 TAAATCGTAATTATTCTTATTTA
Bacillus clausii KSM-K16
ABC1702 znuC -39 5.1 TAAATCGGAAGCATTCTGAATAA
ABC1118 zinT -54 6.8 CAAAACGTAATAATTACGATTTA
ABC4020 yciC -40 6.9 TAATTCGTAATCATTACGATTTA
ABC4019 rpsN2 -45 6.1 TAAATCGTAATAATAATGATTTT
ABC1118 zinT -54 6.8 CAAAACGTAATAATTACGATTTA
ABC1119 null -85 6.2 TAAATCGTAATTGATACGATTTG
Oceanobacillus iheyensis HTE831
OB1278 zinT -41 6 CGAATCGTAATCATTACGATTAC
OB1278 zinT -57 6.2 TAAATCGTAACCATTACGAATCG
OB3429 yciC -82 6.3 TTAATCGTAATGATTACGTTTTT
OB3432 rpsN2 -247 6 TTAATCGTAATCGTTACGATGTA
OB3433 null -55 5 TTATTCGTAATGATTACGGATAT
OB3434 OB3434 -40 6.9 TAAATCGTAATGATTACGTTTTG
OB2396 znuC -297 6 TAATTCGTAACGATTCCTATTTA
OB2396 znuC -274 5.1 CATTTCATAATCATTACGCTATT
Paenibacillus sp. JDR-2
Pjdr2_3068 yciC -35 5.1 TTAATAGTAATGATTACGGAAAA
Pjdr2_3065 null -67 5.8 CTAATCGTAATAGTTACGAAATA
Pjdr2_3065 null -118 5.2 TTATACGTAATTATTACGTTCAA
Pjdr2_3065 null -162 5.6 TTAATCGTAATGTTGACGATTAA
Pjdr2_3068 null -35 5.1 TTAATAGTAATGATTACGGAAAA
Pjdr2_3065 adcC -67 5.8 CTAATCGTAATAGTTACGAAATA
Pjdr2_3065 adcC -118 5.2 TTATACGTAATTATTACGTTCAA
Pjdr2_3065 adcC -162 5.6 TTAATCGTAATGTTGACGATTAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD