Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator MntR in Bacillales

Properties
Regulator family: DtxR
Regulation mode: repressor (activator)
Biological process: Manganese homeostasis
Effector: Manganese ion, (Mn2+)
Regulog: MntR - Bacillales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bacillus subtilis subsp. subtilis str. 168
BSU04360 mntH -60 6 TAATTTGCCTTAAGGAAACTCT
BSU30770 mntA -131 5.7 AATTTTGCATGAGGGAAACTTT
Bacillus amyloliquefaciens FZB42
RBAM_004660 mntH -65 5.7 TAATTTGCATCTAGGAAACTTT
Bacillus pumilus SAFR-032
BPUM_0413 mntH -63 5.8 AAAATTGCATCAAGGAAACATT
BPUM_3011 mntB -119 5.8 AAAGTTTCCCTAAGGAAACAAA
Bacillus licheniformis DSM 13
BLi00526 mntH -62 6.3 AAATTTGCACTAAGGAAACTTT
Anoxybacillus flavithermus WK1
Aflv_1289 mntA -92 6 TATGTTGCATTGAGGAAACTTT
Geobacillus kaustophilus HTA426
GK0583 mntH -53 6.1 AAAGTTTCCTTAATGCAAAATA
Bacillus cereus ATCC 14579
BC1803 mntH -129 6.3 TAATTTGCATTAAGGAAACTTT
BC0709 feoA -61 5.8 AAAGTTTACCTTAGGAAACTTT
Bacillus halodurans C-125
BH1389 mntB -180 6.2 AAAGTTTACTTAGGGAAACTTT
BH0516 mntA -54 5.5 TGTTTTGCCTTGGGGAAACTTT
Bacillus clausii KSM-K16
ABC3961 mntA -99 6 AAAGTTGCATTAGAGAAACTTT
Oceanobacillus iheyensis HTE831
OB0431 mntA -38 5.9 AAAGTTTACCTAAGGCAAAATT
OB0431 mntA -123 5.6 AAAGTTTCCTTAGTGCAAAAAA
Paenibacillus sp. JDR-2
Pjdr2_4868 mntA -109 5.5 AATGTTGCATCAGAGAAACATT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD