Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator LicR in Bacillales

Properties
Regulator family: BglG
Regulation mode: activator
Biological process: Beta-glucosides utilization
Effector: HPr, phosphocarrier protein; LicB, lichenan-specific enzyme IIB PTS component
Regulog: LicR - Bacillales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bacillus subtilis subsp. subtilis str. 168
BSU38590 licB -111 5.5 TTTTCCGTTGCCTGCGGAAAA
Bacillus amyloliquefaciens FZB42
RBAM_035790 licB -109 6.2 TTTTCCGTTAACAGCGGAAAA
Bacillus pumilus SAFR-032
BPUM_3506 licB -105 5.7 TTTCCGCTTCCTAAAGGAAAA
Bacillus clausii KSM-K16
ABC0481 licB -123 5.4 TTTTCCGTTTATATGGCTAAA
Oceanobacillus iheyensis HTE831
OB2760 licB -97 5.7 TTTTCCGTTACACAGCGGAAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD