Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator GanR in Bacillales

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Galactan utilization
Effector: Beta-galactosides
Regulog: GanR - Bacillales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bacillus subtilis subsp. subtilis str. 168
BSU34170 ganR -54 6.6 GAAAGTAAAATATTTTACTAAA
BSU34160 ganO -109 5.9 TTAGGTAAAAAAATTTACTCTA
Bacillus pumilus SAFR-032
BPUM_3612 ganR -74 5.6 TTTAATAAAAATATTTACTAAT
BPUM_3613 ganO -126 6.8 TTGAGTAAAAAATTTTACTTAA
Bacillus licheniformis DSM 13
BLi04281 ganR -69 7 ATTAGTAAAATATTTTACTAAA
BLi04280 ganO -110 5.8 TTTCGTAAAACATTTTACCTGT
Bacillus halodurans C-125
BH2019 ganO -127 5.9 TTTCCGAAAATATTTTACTCAT
Bacillus clausii KSM-K16
ABC3520 ganO -108 7.2 TTAAGTAAAATATTTTACTAAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD