Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator HrcA in Bacillales

Properties
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Regulog: HrcA - Bacillales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bacillus subtilis subsp. subtilis str. 168
BSU25490 hrcA -41 7.5 TTAGCACTCGCTTATTGAGAGTGCTAA
BSU06020 groES -62 7.4 TTAGCACTCTTTAGTGCTGAGTGCTAA
Bacillus amyloliquefaciens FZB42
RBAM_023790 hrcA -41 7.3 TTAGCACTCGCTGACCTTGAGTGCTAA
RBAM_006470 groES -62 7.4 TTAGCACTCTTTAGAGCTGAGTGCTAA
Bacillus pumilus SAFR-032
BPUM_2282 hrcA -41 7.5 TTAGCACTCGTTGAAAGAGAGTGCTAA
BPUM_0534 groES -65 7.5 TTAGCACTCACTGGTGATGAGTGCTAA
Bacillus licheniformis DSM 13
BLi02741 hrcA -41 7.3 TTAGCACTCAGTTGTGCCGAGTGCTAA
BLi00623 groES -61 7.3 TTAGCACTCACCGAGTGCGAGTGCTAA
Anoxybacillus flavithermus WK1
Aflv_0833 hrcA -42 7.4 TTAGCACTCGCTTTGTTAGAGTGCTAA
Aflv_0211 groES -64 7.5 TTAGCACTCGACCGTAATGAGTGCTAA
Geobacillus kaustophilus HTA426
GK2506 hrcA -41 7.4 TTAGCACTCGAATTGTTCGAGTGCTAA
GK0248 groES -69 7.6 TTAGCACTCAATAGTGATGAGTGCTAA
Bacillus cereus ATCC 14579
BC4314 hrcA -43 7.4 TTAGCACTCAAAGACAAAGAGTGCTAA
BC0294 groES -67 7.2 TTAGCACTCGGATGACTTGAGTGCTAA
Bacillus halodurans C-125
BH1007 htpG -126 7.1 TTAGCACTCGTTGCTTGCAAGTGCTAA
BH1344 hrcA -114 7.3 TTAGCACTCGAACTATGAGAGTGCTAA
BH0561 groES -66 7.5 TTAGCACTCGTTTGAAGAGAGTGCTAA
Bacillus clausii KSM-K16
ABC0970 htpG -63 7.5 TTAGCACTCTAAACAAACGAGTGCTAA
ABC1657 hrcA -41 7.5 TTAGCACTCGTTGCATTTGAGTGCTAA
ABC0881 groES -63 7.3 TTAGCACTCATCGAATCCGAGTGCTAA
Oceanobacillus iheyensis HTE831
OB3158 htpG -52 7.6 TTAGCACTCGTAAGTAGTGAGTGCTAA
OB1970 hrcA -41 7.4 TTAGCACTCAATAATCAAGAGTGCTAA
OB0655 groES -65 7.5 TTAGCACTCATCTATGAAGAGTGCTAA
Paenibacillus sp. JDR-2
Pjdr2_5425 htpG -64 7 TTAGCACTCCAACACGGAGAGTGCTAA
Pjdr2_2205 hrcA -62 7.2 TTAGCACTCGGGCCTAATGAGTGCTAA
Pjdr2_1050 groES -70 6.8 TTAGCACTTCAAGCTTACGAGTGCTAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD