Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator GlvR2 in Bacillales

Properties
Regulator family: RpiR
Regulation mode:
Biological process: Maltose utilization
Effector: Maltose-6-phosphate
Regulog: GlvR2 - Bacillales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bacillus pumilus SAFR-032
BPUM_0660 glvC -130 7.1 TGAAAATATTTTCTTTCTGTGAAAA
BPUM_0659 glvR2 -51 5.4 AGATTATATTTTCACAGAAAGAAAA
Bacillus clausii KSM-K16
ABC3580 glvC -130 6.8 TGAAAATATTTTCCTTCTGTGAAAA
ABC3579 glvR2 -28 4.9 GGAAAATATTTTCATAGAAGGTGAG
ABC3579 glvR2 -47 5.2 AGATTATATTTTCACAGAAGGAAAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD