Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator GlvR in Bacillales

Properties
Regulator family: RpiR
Regulation mode: activator
Biological process: Maltose utilization
Effector: Maltose-6-phosphate
Regulog: GlvR - Bacillales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bacillus subtilis subsp. subtilis str. 168
BSU08180 glvA -129 7.6 GAGAAATTTCCCGCTCTATGGGAAAAA
Bacillus amyloliquefaciens FZB42
RBAM_008360 glvA -129 7.7 GGGAACTTTCCCGCTTTTTGAGAAAAA
Bacillus licheniformis DSM 13
BLi00855 glvA -129 7.5 GGGAAAGTTCCCGTTTTTCGGGAAAAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD