Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CggR in Bacillales

Properties
Regulator family: SorC
Regulation mode: repressor
Biological process: Glycolysis
Effector: Fructose-1,6-diphosphate
Regulog: CggR - Bacillales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bacillus subtilis subsp. subtilis str. 168
BSU33950 cggR -64 8.8 CGGGACGTTTTTTGTCATAGCGGGACATATAATGTCC
Bacillus amyloliquefaciens FZB42
RBAM_031310 cggR -65 8.6 TGGGACGTTTTTTGTCATAGCGGGACATTTTCTGTCC
Bacillus pumilus SAFR-032
BPUM_3058 cggR -63 8.2 CGGGACGTTTTTTGTCACAGTGGGACTTTTTTAGTCC
Bacillus licheniformis DSM 13
BLi03666 cggR -64 8.3 TGGGACGTTTTCAGTCACTGCGGGACATTATTCGTCC
Anoxybacillus flavithermus WK1
Aflv_2519 cggR -75 8.5 TGGGACATAATAAGTCATAGCGGGACTTAAAACGTCC
Geobacillus kaustophilus HTA426
GK3059 cggR -84 6.4 AGGAATTTTTTATGGCACTGCGGGACATAATATGTCA
GK3059 cggR -64 8.6 CGGGACATAATATGTCATACCGGGACATAAAATGTCC
Bacillus cereus ATCC 14579
BC5141 cggR -61 8.1 TGGGACACAAAATGTCACTACGGGACGTAAAGTGACC
Bacillus halodurans C-125
BH3561 cggR -77 6.6 CGGGACGTAAAATGTCTATGAGGGTCAAAAAACGTCC
Bacillus clausii KSM-K16
ABC3022 cggR -59 7.1 CGGGACATAATATGTCTGCGAGGGACGTTATATGTCC
Oceanobacillus iheyensis HTE831
OB2439 cggR -58 6.2 CGGGACATAATGTAACCATACGGGACGTATTTAGACC
Paenibacillus sp. JDR-2
Pjdr2_0176 cggR -88 6.2 TGGGACTTAAAGTGAGTATGCGGGACGTTTAACGTCC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD