Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator IolR in Thermotogales

Properties
Regulator family: ROK
Regulation mode: repressor
Biological process: Inositol utilization
Effector:
Regulog: IolR - Thermotogales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Thermotoga maritima MSB8
TM0411 iolR -39 6 GTTGGTTAGTTAACGATAACAAA
Thermotoga neapolitana DSM 4359
CTN_0258 iolR -40 6.3 GTTGGTTAGTAAATGAAAACAAA
Thermotoga petrophila RKU-1
Tpet_0509 iolR -40 6.3 GTTGGTTAGTAAATGAAAACAAA
Thermotoga naphthophila RKU-10
Tnap_0203 iolR -40 6.3 GTTGGTTAGTAAATGAAAACAAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD