Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator HrcA in Thermotogales

Properties
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Regulog: HrcA - Thermotogales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Thermotoga maritima MSB8
TM0370 TM0370 -16 5.9 TTATCAAAAGAAAAAAATGATTGCTAA
TM0373 dnaK -179 5.7 TTATCATTCAAACATTTCATTTGCTAT
TM0851 hrcA -30 6.5 TTAGCACTCAAAAGAAGGGAGTGCTAA
TM0505 groS -48 6.6 TTAGCAGTCGAATGATGAGAGTGCTAA
Thermotoga sp. RQ2
TRQ2_0431 groS -48 6.4 TTAGCAGTCGAACGATGAGAGTGCTAA
TRQ2_0054 clpA -51 6.3 TTATCAAACGTAAGATTTAAGTGCTAA
TRQ2_0558 dnaK -179 5.9 TTATCATTCAAAAGTTTCATTTGCTAT
TRQ2_0076 hrcA -30 6.5 TTAGCACTCAAAAGAAGGGAGTGCTAA
Thermotoga neapolitana DSM 4359
CTN_0166 groS -52 6.2 TTAGCAGTCATGAGTCGAGAGTGCTAA
CTN_1702 clpA -42 6.3 TTATCATTCTTAATAATTAAGTGCTAA
CTN_0304 dnaK -174 6.2 TTATCATTCATAAGTTTCGTTTGCTAT
CTN_0301 TM0370 -20 6.4 TTATCAATCGATATTGATGAGTGCTAA
CTN_1724 hrcA -28 6.6 TTAGCACTCAAAAGAAAGGAGTGCTAA
Thermotoga petrophila RKU-1
Tpet_0416 groS -48 6.4 TTAGCAGTCGAACGATGAGAGTGCTAA
Tpet_0054 clpA -51 6.6 TTATCAAACGTAATATTTGAGTGCTAA
Tpet_0544 dnaK -179 5.9 TTATCATTCAAAAGTTTCATTTGCTAT
Tpet_0547 TM0370 -49 6.4 TTATCAAACGAAAAAAATGATTGCTAA
Tpet_0076 hrcA -30 6.5 TTAGCACTCAAAAGAAGGGAGTGCTAA
Thermotoga naphthophila RKU-10
Tnap_0168 dnaK -179 5.9 TTATCATTCAAAAGTTTCATTTGCTAT
Tnap_0286 groS -48 6.1 TTAGCAGTCAGACGATGAGAGTGCTAA
Tnap_0165 TM0370 -49 6.4 TTATCAAACGAAAAAAATGATTGCTAA
Tnap_0054 clpA -51 6.6 TTATCAAACGTAATATTTGAGTGCTAA
Tnap_0076 hrcA -30 6.5 TTAGCACTCAAAAGAAGGGAGTGCTAA
Thermotoga lettingae TMO
Tlet_0014 dnaK -169 5.9 GTATCAGTCTATAATTACGAGTGCTAT
Tlet_0318 groS -57 6.5 TTAGCACTCAAACAGTTCGAGTGATAA
Tlet_1782 hrcA -29 6.8 TTAGCACTCAAATGATGAGAGTGATAA
Thermosipho africanus TCF52B
THA_270 groS -53 5.9 TTAGCAGTCAATGAATTAGAGTGACAA
THA_711 clpA -54 6.6 TTATCAGTCTAAATATATGACTGATAA
THA_1433 dnaK -59 6.3 TTATCACTCTTGACAAAAGACTGCTAA
THA_1433 dnaK -159 5.2 ATAACAAACTTATGTAACAATTGCTAT
THA_306 hrcA -28 5.8 TTATCAGACAAGGATAAAGAGTGATAA
Thermosipho melanesiensis BI429
Tmel_0053 groS -54 5.8 TTAGCAGTCGATGATTAAGAGTGACAA
Tmel_0413 clpA -55 6.3 TTATCAGTCTATATATGTGACTGATAA
Tmel_1128 dnaK -157 5.6 ATAACAAACGAATGTTACGATTGCTAT
Tmel_1128 dnaK -57 6.5 TTATCACTCTTGACAATAGAGTGATAA
Tmel_0089 hrcA -51 6.1 TTATCAGACATAGCATAAGAGTGATAA
Fervidobacterium nodosum Rt17-B1
Fnod_1242 hrcA -103 5.1 TTGGCAGATGGATAATAAGTTTGCTAA
Fnod_1544 groS -61 5.8 TTAACAAACGGAATATTAGAGTGATAA
Fnod_0102 hsp20 -244 5.7 TTATCATTATTAAGTTACAACTGATAA
Fnod_1362 recF -93 5.8 TTATCACTCCATCTTGTCAAGTGATAA
Fnod_1209 dnaK -82 6.4 TTATCACTCTTGACAAATGATTGCTAA
Fnod_0310 clpB -85 6 ATATCACTCTTGACATATAAGTGATAA
Fnod_0102 hsp20 -141 6.5 TTATCACTCTTGACAATTGAGTGATAA
Petrotoga mobilis SJ95
Pmob_1649 dnaK -205 5.7 TTTTCACTCTTAGATTAAGAGTGATAT
Pmob_1157 groS -85 6.9 TTAGCACTCTTAATATTTGATTGCTAA
Pmob_1629 clpA -68 6.3 TTAGCAAATAAAAGTAACGAGTGATAA
Pmob_1823 hrcA -28 5.8 TTAGCACTTAATATGCGGGAGTGATAA
Thermotogales bacterium TBF 19.5.1
Kole_0886 dnaK -82 5.6 ATGGCAAACTTGACATTCGATTGCTAA
Kole_1626 groS -71 6.3 TTAGCAGACTCATATAAAGAGTGCTAA
Kole_1384 hrcA -28 5.6 TTAGCAGTCTCCAGGGAGGAGTGCTAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD