Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator HcpR in Thermotogales

Properties
Regulator family: CRP
Regulation mode: activator
Biological process: Nitrosative stress response
Effector: Nitric oxide
Regulog: HcpR - Thermotogales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Thermotoga maritima MSB8
TM1171 hcpR -28 6.5 TCTGTAACAATTGTTACGGG
TM1172 hcp -87 6.5 CCCGTAACAATTGTTACAGA
Thermotoga sp. RQ2
TRQ2_1644 hcpR -31 6.7 TCCGTAACAATTGTTACGGG
TRQ2_1643 hcp -80 6.7 CCCGTAACAATTGTTACGGA
Thermotoga neapolitana DSM 4359
CTN_1403 hcp -50 6.7 CCCGTAACAATTGTTACGGA
Thermotoga petrophila RKU-1
Tpet_1578 hcpR -28 6.3 TCTGTAACAATTGTTACGAG
Tpet_1577 hcp -81 6.3 CTCGTAACAATTGTTACAGA
Thermotoga naphthophila RKU-10
Tnap_1598 hcpR -28 6.3 TCTGTAACAATTGTTACGAG
Tnap_1597 hcp -81 6.3 CTCGTAACAATTGTTACAGA
Thermotoga lettingae TMO
Tlet_1357 hcpR -20 5.6 GCGGTAACATATGATACAGA
Tlet_0222 hcp -79 5.7 TTCGTAACAAAAGTTACTGT
Thermosipho africanus TCF52B
THA_824 hcp -79 6.1 TTCGTAACCTATGTTACAGA
THA_1919 hcp -84 6.4 TCCGTAACTAATGTTACAGA
Thermosipho melanesiensis BI429
Tmel_0755 ytfE -59 5.9 AGCGTAACATAAGTTACGGA
Fervidobacterium nodosum Rt17-B1
Fnod_1303 hcpR -229 6.5 TCCGTAACCTATGTTACGGA
Fnod_1302 hcp -92 6.5 TCCGTAACATAGGTTACGGA
Petrotoga mobilis SJ95
Pmob_1162 hcpR -52 6.2 TCAGTAACAAATGTTACGCA
Pmob_1163 hcp -132 6.2 TGCGTAACATTTGTTACTGA
Thermotogales bacterium TBF 19.5.1
Kole_1156 hcpR -28 6.6 TCGGTAACATATGTTACGGA
Kole_1155 ytfE -86 6.6 TCCGTAACATATGTTACCGA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD