Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator ChiR in Thermotogales

Properties
Regulator family: ROK
Regulation mode: repressor
Biological process: Chitobiose utilization
Effector: Chitobiose
Regulog: ChiR - Thermotogales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Thermotoga maritima MSB8
TM0808 chiR -27 6.9 AAGTTGTTTGCGGCATGCAACTA
Thermotoga sp. RQ2
TRQ2_0118 chiR -43 6.9 AAGTTGTTTGCGGCATGCAACTA
Thermotoga neapolitana DSM 4359
CTN_1770 chiR -44 6.8 TAGTTGCTTGCAACACGCAACTA
Thermotoga petrophila RKU-1
Tpet_0120 chiR -43 7 AAGTTGTTTGCAGCATGCAACTA
Thermotoga naphthophila RKU-10
Tnap_0121 chiR -43 7 AAGTTGTTTGCAGCATGCAACTA
Thermotoga lettingae TMO
Tlet_0036 chiR -39 6.3 TAGTTGCAGTATGCAAGCAACTA
Thermosipho africanus TCF52B
THA_1058 chiR -42 6.5 TAGTTGATTGAAACAACCAACTA
Thermosipho melanesiensis BI429
Tmel_0688 chiR -38 6.9 TAGTTGATTGAAGCAATCAACTA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD