Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator GluR in Thermotogales

Properties
Regulator family: ROK
Regulation mode: repressor
Biological process: Glucose utilization; Trehalose utilization
Effector: Glucose
Regulog: GluR - Thermotogales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Thermotoga sp. RQ2
TRQ2_0970 treE -48 6 ATTTGATTACAACGTCATTTAAC
TRQ2_0973 gluE -121 6.3 ATTTAATTCCTTTGGAAATTAAT
Thermotoga neapolitana DSM 4359
CTN_0777 gluE -121 6.3 ATTTGATTCCGTTGGAAATTAAT
CTN_0781 amyE -387 4.8 ATTTgATTAtAccGTcAgTTAAc
Thermotoga petrophila RKU-1
Tpet_0953 amyE -52 6 ATTTGATTATAACGTCATTTAAT
Thermotoga naphthophila RKU-10
Tnap_0601 amyE -52 6 ATTTGATTATAACGTCATTTAAT
Tnap_0597 gluE -133 6.3 ATTTAATTCCTTTGGAAATTAAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD