Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator BglR in Thermotogales

Properties
Regulator family: ROK
Regulation mode: repressor
Biological process: Beta-glucosides utilization
Effector: Cellobiose
Regulog: BglR - Thermotogales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Thermotoga maritima MSB8
TM0032 bglR -45 6.8 AATTTCTTTCTGAGGAAGATAGA
Thermotoga sp. RQ2
TRQ2_0913 bglR -45 6.8 AATTTCTTTCTGAGGAAGATAGA
Thermotoga neapolitana DSM 4359
CTN_0660 bglX -49 6.5 AATTCCTTTCTGAGGAAGATAAT
Thermotoga petrophila RKU-1
Tpet_0891 bglR 29 6.8 AATtTCTTTCTGAGgAAGATAga
Thermotoga naphthophila RKU-10
Tnap_0663 bglR -45 6.8 AATTTCTTTCTGAGGAAGATAGA
Thermotoga lettingae TMO
Tlet_1036 bglB -121 6 TAAATCTTTTTCAGAAAGATAAA
Tlet_1037 bglR -55 6.3 AAAATCTTTTTTAGAAAGATATT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD