Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator AraR in Thermotogales

Properties
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Arabinose utilization
Effector: Arabinose
Regulog: AraR - Thermotogales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Thermotoga maritima MSB8
TM0280 glsA -44 5.9 AATAATGTACGTACCTAAAT
TM0278 araF -1396 4.7 ccAtcGGTACGTACCgTTAT
TM0276 araA -164 4.7 ATAACGGTACGTACCGATGG
TM0276 araA -62 6.3 ATAATGGTACGTACTTTTAT
TM0278 araF -1498 6.3 ATAAAaGTACGTACCaTTAT
Thermotoga sp. RQ2
TRQ2_0672 araA -62 6.5 ATAAAGGTACGTACTTTTAT
TRQ2_0672 araA -164 4.7 ATAACGGTACGTACCGATGG
TRQ2_0661 araN-II -50 5.7 AAATTGGTACGTACCTATCT
TRQ2_0668 glsA -58 5.9 AATAATGTACGTACCTAAAT
TRQ2_0671 araE -150 6.5 ATAAAAGTACGTACCTTTAT
TRQ2_0671 araE -48 4.7 CCATCGGTACGTACCGTTAT
TRQ2_0662 abf6 -221 5.7 AGATAGGTACGTACCAATTT
TRQ2_0662 abf6 -38 5.4 ATATATGTACGTACAAAATG
TRQ2_0661 araN-II -233 5.4 CATTTTGTACGTACATATAT
Thermotoga neapolitana DSM 4359
CTN_0409 araA -62 6.2 ATAAAGGTACGTACTTTTGT
CTN_0409 araA -165 4.7 ATATCGGTACGTACCAGTTG
CTN_0408 araE -136 6.2 ACAAAAGTACGTACCTTTAT
CTN_0408 araE -33 4.7 CAACTGGTACGTACCGATAT
Thermotoga petrophila RKU-1
Tpet_0648 araA -62 6.5 ATAAAGGTACGTACTTTTAT
Tpet_0648 araA -164 4.7 ATAACGGTACGTACCGATGG
Tpet_0647 araE -150 6.5 ATAAAAGTACGTACCTTTAT
Tpet_0647 araE -48 4.7 CCATCGGTACGTACCGTTAT
Tpet_0637 abf6 -221 5.7 AGATAGGTACGTACCAATTT
Tpet_0637 abf6 -38 5.4 ATATATGTACGTACAAAATG
Tpet_0643 glsA -55 5 GATAATATACGTACCTAAAT
Tpet_0636 araN-II -233 5.4 CATTTTGTACGTACATATAT
Tpet_0636 araN-II -50 5.7 AAATTGGTACGTACCTATCT
Thermotoga naphthophila RKU-10
Tnap_0906 araA -62 6.5 ATAAAGGTACGTACTTTTAT
Tnap_0906 araA -164 4.7 ATAACGGTACGTACCGATGG
Tnap_0907 araE -150 6.5 ATAAAAGTACGTACCTTTAT
Tnap_0907 araE -48 4.7 CCATCGGTACGTACCGTTAT
Tnap_0910 glsA -55 5 GATAATATACGTACCTAAAT
Tnap_0913 Tnap_0913 -56 4.9 TATAATGTACGTACCTATCA
Thermotoga lettingae TMO
Tlet_1143 araN-II -169 5 TAATTTGTATGTACATATAT
Tlet_1138 araR 27 5.3 ATTTATGTACGTACGTTTAC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD