Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator HisR in Staphylococcaceae

Properties
Regulator family: TrpR
Regulation mode: repressor
Biological process: Histidine biosynthesis
Effector: Histidine
Regulog: HisR - Staphylococcaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Staphylococcus aureus subsp. aureus N315
SA0804 yuiF -38 5 CGCTTTAGTTCGATAGAGCG
SA0417 SA0417 -27 5.5 CGCTTTAACGCTTTAAAGGA
SA2472 hisZ -84 4.7 CACTTTAGTGTGGTAGAGAA
SA1723 hisR -62 5.2 CACTTTAATAGATTAATGCG
Staphylococcus capitis SK14
STACA0001_0183 yuiF -39 4.9 TACTTTAGTTCGATAGAGTG
STACA0001_1477 SA0417 -30 5.6 CACTTTAGCGCTTTAAAGGG
STACA0001_1960 hisR -60 5.1 CACTTTAACTAATTAGTACG
Staphylococcus epidermidis ATCC 12228
SE0637 yuiF -37 4.9 TACTTTAGTTCGATAGAGTG
SE2326 SA0417 -108 5.6 CACTTTAGCGCTTTAAAGGG
SE0270 hisZ -56 3.9 TACTTTAATGTATTATCGAA
SE1592 hisR -60 5 CACTTTAACGAATTAGTAAG
Staphylococcus carnosus subsp. carnosus TM300
Sca_0548 yuiF -37 4.2 TGCTTTAGTTCGATAACGTA
Sca_0085 SA0417 -143 5.7 CGCTTTAACGCTTTAAAGTA
Sca_0637 hisZ -50 4.9 TACTTTAGTTCGGTAGAGAG
Sca_1481 hisR -60 5.1 CACTTTAACGTATTAGTACG
Staphylococcus haemolyticus JCSC1435
SH2008 yuiF -37 4.9 TACTTTAGTTCGGTAGAGAG
SH2552 SA0417 -108 5.9 CGCTTTAACGCGTTAAAGGG
SH1044 hisR -65 5.4 CACTTTAACTATTTAATGCG
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
SSP1832 yuiF -38 4.5 TACTTTAGTTCGATAACGTG
SSP2298 SA0417 -47 5.1 CGCTTTAACGCAATAAAGCT
SSP0431 hisZ -49 4.6 TACTTTAGTTCGGTAGAGAA
SSP0883 hisR -61 5.1 CACTTTAATGTACTAATACG
Macrococcus caseolyticus JCSC5402
MCCL_0570 yuiF -47 4.2 TACTTTAGTATGCTAATATA
MCCL_0041 SA0417 -33 5.4 CACTTTACAGCGTTAAAACG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD